MystiCq^?microRNA qPCR Assay Primer

hsa-miR-31-5p Sanger Database

NA.55

The MystiCq ^?microRNA qPCR Assay Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific microRNAs with the MystiCq Universal PCR primer and the MystiCq ^?microRNA SYBR ^?Green qPCR ReadyMix ^?on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix kit.

• Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs
• Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence
• No self-complementarity or primer dimer artifacts with the Universal PCR Primer
• Optimized primer Tm designed to match the Universal PCR Primer
• Universal cycling conditions ensures robust amplification for all assays in profiling experiments
• Optimized PCR product Tm (75-78° C)

Formerly hsa-miR-31. Compatible with mmu-miR-31 and rno-miR-31.

MystiCq is a registered trademark of Qiagen Beverly Inc.
ReadyMix is a trademark of sigma-aldrich Co. LLC
SYBR is a registered trademark of Life Technologies

liquid

10 mg/mL

AGGCAAGAUGCUGGCAUAGCU

~77 ℃

MIMAT0000089

wet ice

?20℃

human ... MIR31(407035)

12 - Non Combustible Liquids

WGK 1